Mature sequence ipu-miR-7562

Accession numberMIMAT0029559
IDipu-miR-7562
Stem-Loop ipu-mir-7562
Sequence
cacacacacucaugaacacaca
Get sequence
Deep sequencing reads, experiments

References

1