Mature sequence ipu-miR-9

Accession numberMIMAT0029528
IDipu-miR-9
Stem-Loop ipu-mir-9-4 ipu-mir-9-2 ipu-mir-9-6 ipu-mir-9-1 ipu-mir-9-3 ipu-mir-9-7 ipu-mir-9-5
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing reads, experiments

References

1