Mature sequence ipu-miR-460

Accession numberMIMAT0029518
IDipu-miR-460
Stem-Loop ipu-mir-460
Sequence
cacagcgcauacaauguggaugc
Get sequence
Deep sequencing reads, experiments

References

1