Mature sequence ipu-miR-455b

Accession numberMIMAT0029513
IDipu-miR-455b
Stem-Loop ipu-mir-455b
Sequence
uaugugcccuuggacuacauug
Get sequence
Deep sequencing reads, experiments

References

1