Mature sequence ipu-miR-455a

Accession numberMIMAT0029512
IDipu-miR-455a
Stem-Loop ipu-mir-455a
Sequence
uaugugcccuuggacuacaucg
Get sequence
Deep sequencing reads, experiments

References

1