Mature sequence ipu-miR-365

Accession numberMIMAT0029507
IDipu-miR-365
Stem-Loop ipu-mir-365-1 ipu-mir-365-2
Sequence
agggacuuuuaggggcagcu
Get sequence
Deep sequencing reads, experiments

References

1