Mature sequence ipu-miR-22a

Accession numberMIMAT0029479
IDipu-miR-22a
Stem-Loop ipu-mir-22a
Sequence
aagcugccagcugaagaacugu
Get sequence
Deep sequencing reads, experiments

References

1