Mature sequence ipu-miR-219a

Accession numberMIMAT0029474
IDipu-miR-219a
Stem-Loop ipu-mir-219a-2 ipu-mir-219a-1
Sequence
agaauugugccuggacaucugu
Get sequence
Deep sequencing reads, experiments

References

1