Mature sequence ipu-miR-20a

Accession numberMIMAT0029462
IDipu-miR-20a
Stem-Loop ipu-mir-20a
Sequence
acugcagugugagcacuugaagu
Get sequence
Deep sequencing reads, experiments

References

1