Mature sequence ipu-miR-199a-5p

Accession numberMIMAT0029450
IDipu-miR-199a-5p
Stem-Loop ipu-mir-199a-1 ipu-mir-199a-2 ipu-mir-199a-4 ipu-mir-199a-3
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing reads, experiments

References

1