Mature sequence ipu-miR-192

Accession numberMIMAT0029446
IDipu-miR-192
Stem-Loop ipu-mir-192
Sequence
augaccuaugaauugacagcc
Get sequence
Deep sequencing reads, experiments

References

1