Mature sequence ipu-miR-183

Accession numberMIMAT0029440
IDipu-miR-183
Stem-Loop ipu-mir-183
Sequence
auggcacugguagaauucacug
Get sequence
Deep sequencing reads, experiments

References

1