Mature sequence ipu-miR-181b

Accession numberMIMAT0029437
IDipu-miR-181b
Stem-Loop ipu-mir-181b-2 ipu-mir-181b-1
Sequence
aacauucauugcugucgguggg
Get sequence
Deep sequencing reads, experiments

References

1