Mature sequence ipu-miR-143

Accession numberMIMAT0029420
IDipu-miR-143
Stem-Loop ipu-mir-143
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing reads, experiments

References

1