Mature sequence ipu-miR-142

Accession numberMIMAT0029419
IDipu-miR-142
Stem-Loop ipu-mir-142-1 ipu-mir-142-2
Sequence
guaguguuuccuacuuuaugga
Get sequence
Deep sequencing reads, experiments

References

1