Mature sequence ghr-miR7496b

Accession numberMIMAT0029143
IDghr-miR7496b
Stem-Loop ghr-MIR7496b
Sequence
augaccaaauugauagaaugugua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22138860 "A comparative miRNAome analysis reveals seven fiber initiation-related and 36 novel miRNAs in developing cotton ovules" Wang ZM, Xue W, Dong CJ, Jin LG, Bian SM, Wang C, Wu XY, Liu JY Mol Plant. 5:889-900(2012).