Mature sequence gga-miR-7469-3p

Accession numberMIMAT0029093
IDgga-miR-7469-3p
Stem-Loop gga-mir-7469
Sequence
uuugugugcuugcauugcaaagg
Get sequence
Deep sequencing3 reads, 2 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).