Mature sequence oan-miR-7431-5p

Accession numberMIMAT0029012
IDoan-miR-7431-5p
Stem-Loop oan-mir-7431
Sequence
caacggacucacucccuucug
Get sequence
Deep sequencing44 reads, 4 experiments

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).