Mature sequence oan-miR-7417-3p

Accession numberMIMAT0028983
IDoan-miR-7417-3p
Stem-Loop oan-mir-7417
Sequence
ugugugcucagagggggcaauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).