Mature sequence mdo-miR-7360-5p

Accession numberMIMAT0028732
IDmdo-miR-7360-5p
Stem-Loop mdo-mir-7360-1 mdo-mir-7360-2 mdo-mir-7360-3 mdo-mir-7360-4 mdo-mir-7360-5 mdo-mir-7360-6 mdo-mir-7360-7 mdo-mir-7360-8
Sequence
uccuuucuguagguauaauauuu
Get sequence
Deep sequencing328 reads, 3 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).