Mature sequence mdo-miR-7293-3p

Accession numberMIMAT0028571
IDmdo-miR-7293-3p
Stem-Loop mdo-mir-7293
Sequence
gcgcuggggaauuucugccac
Get sequence
Deep sequencing11793 reads, 5 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).