Mature sequence mmu-miR-7232-5p

Accession numberMIMAT0028432
IDmmu-miR-7232-5p
Stem-Loop mmu-mir-7232
Sequence
uacauggaugauuguuuuuccaag
Get sequence
Deep sequencing661 reads, 13 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).