Mature sequence mml-miR-1247-3p

Accession numberMIMAT0028359
IDmml-miR-1247-3p
Stem-Loop mml-mir-1247
Sequence
cgggaacgucgagacuggagc
Get sequence
Deep sequencing97 reads, 9 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).