Mature sequence hsa-miR-7160-5p

Accession numberMIMAT0028230
IDhsa-miR-7160-5p
Stem-Loop hsa-mir-7160
Sequence
ugcugagguccgggcugugcc
Get sequence
Deep sequencing4 reads, 3 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).