Mature sequence hsa-miR-7157-3p

Accession numberMIMAT0028225
IDhsa-miR-7157-3p
Stem-Loop hsa-mir-7157
Sequence
ucugugcuacuggaugaagagu
Get sequence
Deep sequencing82 reads, 6 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).