Mature sequence hsa-miR-7153-5p

Accession numberMIMAT0028216
IDhsa-miR-7153-5p
Stem-Loop hsa-mir-7153
Sequence
ugagaacugacaaaugugguagg
Get sequence
Deep sequencing190 reads, 2 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).