Mature sequence dre-miR-7148-5p

Accession numberMIMAT0028206
IDdre-miR-7148-5p
Stem-Loop dre-mir-7148
Sequence
auggaaauacucgcugauacug
Get sequence
Deep sequencing207 reads, 10 experiments

References

1
PMID:22408181 "Transcriptome-wide analysis of small RNA expression in early zebrafish development" Wei C, Salichos L, Wittgrove CM, Rokas A, Patton JG RNA. 18:915-929(2012).