Mature sequence dev-miR-D22-3p

Accession numberMIMAT0028199
IDdev-miR-D22-3p
Stem-Loop dev-mir-D22
Sequence
gucacacaaggcggcuagcagg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22492913 "Novel microRNAs encoded by duck enteritis virus" Yao Y, Smith LP, Petherbridge L, Watson M, Nair V J Gen Virol. 93:1530-1536(2012).