Mature sequence hsa-miR-7108-3p

Accession numberMIMAT0028114
IDhsa-miR-7108-3p
Stem-Loop hsa-mir-7108
Sequence
acccgcccgucuccccacag
Get sequence
Deep sequencing9 reads, 6 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).