Mature sequence ddi-miR-7095-5p

Accession numberMIMAT0028097
IDddi-miR-7095-5p
Stem-Loop ddi-mir-7095
Sequence
uuccauuuuuaacagauacaa
Get sequence
Deep sequencing reads, experiments

References

1