Mature sequence mmu-miR-6974-5p

Accession numberMIMAT0027850
IDmmu-miR-6974-5p
Stem-Loop mmu-mir-6974
Sequence
gugaggcagcaagagauugggggu
Get sequence
Deep sequencing59 reads, 16 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).