Mature sequence mmu-miR-6970-3p

Accession numberMIMAT0027843
IDmmu-miR-6970-3p
Stem-Loop mmu-mir-6970
Sequence
ucacgccacccacccugugcu
Get sequence
Deep sequencing58 reads, 32 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).