Mature sequence hsa-miR-6881-5p

Accession numberMIMAT0027662
IDhsa-miR-6881-5p
Stem-Loop hsa-mir-6881
Sequence
ugggguaaggauaggaggguca
Get sequence
Deep sequencing22 reads, 12 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).