Mature sequence hsa-miR-6818-5p

Accession numberMIMAT0027536
IDhsa-miR-6818-5p
Stem-Loop hsa-mir-6818
Sequence
uugugugaguacagagagcauc
Get sequence
Deep sequencing186 reads, 66 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).