Mature sequence hsa-miR-6740-3p

Accession numberMIMAT0027382
IDhsa-miR-6740-3p
Stem-Loop hsa-mir-6740
Sequence
ugucuucucuccucccaaacag
Get sequence
Deep sequencing57 reads, 27 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).