Mature sequence hsa-miR-6720-5p

Accession numberMIMAT0027345
IDhsa-miR-6720-5p
Stem-Loop hsa-mir-6720
Sequence
uuccagcccugguaggcgccgcg
Get sequence
Deep sequencing406 reads, 50 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).