Mature sequence ppe-miR6277

Accession numberMIMAT0027306
IDppe-miR6277
Stem-Loop ppe-MIR6277
Sequence
uguguguggaaagagcgagac
Get sequence
Deep sequencing reads, experiments

References

1