Mature sequence mml-miR-4446-5p

Accession numberMIMAT0027105
IDmml-miR-4446-5p
Stem-Loop mml-mir-4446
Sequence
ccauuucccugccauucccuuggc
Get sequence
Deep sequencing24 reads, 4 experiments
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).