Mature sequence hsa-miR-2276-5p

Accession numberMIMAT0026921
IDhsa-miR-2276-5p
Stem-Loop hsa-mir-2276
Sequence
gcccucugucaccuugcagacg
Get sequence
Deep sequencing61 reads, 30 experiments
Predicted targets

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).