Mature sequence mml-miR-33b-3p

Accession numberMIMAT0026808
IDmml-miR-33b-3p
Stem-Loop mml-mir-33b
Sequence
gugccucggcagugcagccc
Get sequence
Deep sequencing25 reads, 7 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).