Mature sequence mml-miR-23b-5p

Accession numberMIMAT0026800
IDmml-miR-23b-5p
Stem-Loop mml-mir-23b
Sequence
ggguuccuggcaugcugauuu
Get sequence
Deep sequencing285 reads, 7 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).