Mature sequence hsa-miR-1537-5p

Accession numberMIMAT0026765
IDhsa-miR-1537-5p
Stem-Loop hsa-mir-1537
Sequence
agcuguaauuagucaguuuucu
Get sequence
Deep sequencing53 reads, 31 experiments
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).