Mature sequence oan-miR-1398-3p

• Accession number: MIMAT0026760
• ID: oan-miR-1398-3p
• Stem-Loop: oan-mir-1398
• Sequence: aguguugucgacuagaggaccg
• Deep sequencing: 45 reads, 3 experiments

References

1. PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).