Mature sequence oan-miR-1398-3p

Accession numberMIMAT0026760
IDoan-miR-1398-3p
Stem-Loop oan-mir-1398
Sequence
aguguugucgacuagaggaccg
Get sequence
Deep sequencing45 reads, 3 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).