Mature sequence hsa-miR-1251-3p

• Accession number: MIMAT0026741
• ID: hsa-miR-1251-3p
• Stem-Loop: hsa-mir-1251
• Sequence: cgcuuugcucagccaguguag
• Deep sequencing: 42 reads, 22 experiments
• Predicted targets:
  • TargetScanVert:hsa-miR-1251-3p
  • miRDB:hsa-miR-1251-3p

References

1. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2. PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).