Mature sequence mdo-miR-22-5p

Accession numberMIMAT0026651
IDmdo-miR-22-5p
Stem-Loop mdo-mir-22
Sequence
aguucuucaguggcgagcuuua
Get sequence
Deep sequencing5240 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).