Mature sequence gga-miR-460a-3p

Accession numberMIMAT0026646
IDgga-miR-460a-3p
Stem-Loop gga-mir-460a
Sequence
cacagcgcauacaauguggauu
Get sequence
Deep sequencing9082 reads, 5 experiments
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).