Mature sequence hsa-miR-520f-5p

Accession numberMIMAT0026609
IDhsa-miR-520f-5p
Stem-Loop hsa-mir-520f
Sequence
ccucuaaagggaagcgcuuucu
Get sequence
Deep sequencing150 reads, 24 experiments
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).