Mature sequence mml-miR-23a-5p

Accession numberMIMAT0026599
IDmml-miR-23a-5p
Stem-Loop mml-mir-23a
Sequence
gguuccuggggaugggauuu
Get sequence
Deep sequencing7 reads, 4 experiments
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).