Mature sequence gga-miR-218-3p

Accession numberMIMAT0026518
IDgga-miR-218-3p
Stem-Loop gga-mir-218-1 gga-mir-218-2
Sequence
caugguucugucaagcaccaug
Get sequence
Deep sequencing681 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).