Mature sequence sbi-miR169d-3p

Accession numberMIMAT0026431
IDsbi-miR169d-3p
Stem-Loop sbi-MIR169d
Sequence
gggcggucaccuuggcuagc
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).